Puzzle card symbols: Difference between revisions

From Perplex City Wiki
Jump to navigationJump to search
m (→‎Individual Puzzle Card Meta Puzzles: boldness of gemstones varies)
No edit summary
 
(25 intermediate revisions by 4 users not shown)
Line 1: Line 1:
{{Season1}}
== General ==
== General ==
Some of the [[Puzzle Cards]] have playing card symbols, risk soldiers, dice, number strings, and obscure shapes on them. Each prime number card has a playing card symbol and part of a letter on it. Other cards have hidden text written in special ink.  
Some of the [[Puzzle Cards]] have playing card symbols, risk soldiers, dice, number strings, and obscure shapes on them. Each prime number card has a playing card symbol and part of a letter on it. Other cards have hidden text written in special ink.  


We believe that [[Combed Thunderclap]] has put this data on the cards to help us find the Cube.  The first meta puzzle solved, the Prime Number puzzle consisting of card symbols and letters, gave us the message 'I STOLE THE CUBE. HELP ME. COMBED THUNDERCLAP.'  The second meta Puzzle solved, found in hidden text written on yellow letters on the Wave 4 card{{Card|223|Secret Location}} says "Five fingers point:half the world; realm; region; feature; last mystery." (Note all punctuation is added.) The solutions to these puzzles follows.
We believe that [[Combed Thunderclap]] has put this data on the cards to help us find the Cube.   
 
The first meta puzzle solved, the Prime Number puzzle consisting of card symbols and letters, gave us the message 'I STOLE THE CUBE. HELP ME. COMBED THUNDERCLAP.'   
 
The second meta Puzzle solved, found in hidden text written on yellow letters on the Wave 4 card{{Card|223|Secret Location}} says "Five fingers point:half the world; realm; region; feature; last mystery." (Note all punctuation is added.)  
 
The details of the solutions to these puzzles follows.


We have several more puzzles to solve.
We have several more puzzles to solve.
Line 13: Line 22:
:''See: '''[[List of Playing Cards]]''' for a plain list.''
:''See: '''[[List of Playing Cards]]''' for a plain list.''


=== Chart of cards with letters ===
When oriented appropriately, these produce a text message on the corners of the cards.  Full Details can be found on the [[Prime Number Message]] page.
 
This message along with other hints lead us to [http://perplexcityacademy.com/libraryofbabel/ Library of Babel subdirectory].  [[Combed Thunderclap]] has used that site  to communicate with us in a few flash updates.
 
== {{Card|223|Secret Location}} ==
 
This card has an additional set of numbers on it which are not related to the other Wave 4 Number Strings.  These are printed in a hard-to-see yellow text and read:<br>
 
"100, 139, 6, 148, 62, 127, 118, 119, 131, 151, 146, 88, 135, 107, 112, 152, 124, 150, 130, 100, 147, 93, 121, 149, 134, 144, 126, 98, 133, 103, 143, 116, 63, 111, 91, 101, 70, 61, 105, 62, 76, 117, 123, 84, 102, 89, 115, 96, 137, 92, 85, 122, 87, 53, 104, 90, 145".<br>


Note the groupings of playing card symbols goes Club-Diamond-Heart-Spade, from Ace to 2 (ace high), forming 13 sets of 3 letters.
This message is a form of [http://en.wikipedia.org/wiki/Beale_ciphers Beale Cipher], and was [[Secret_Location_Meta_Information_Solution|successfully decoded]] on the 30th of October, 2006. When decoded it says:


[[Image:Letters-on-the-cards-thumb.jpg|right]]
{{quote}}
Five fingers point<br>


{| cellpadding=10 border=1
half the world<br>
|-----
realm<br>
|
region<br>
| Clubs
feature<br>
|
last mystery<br>
| Diamonds
|
| Hearts
|
| Spades
|-----
| Ace
| [http://perplexcitycardcatalog.com/view.php?item=211 211]
|
| [http://perplexcitycardcatalog.com/view.php?item=083 083]
|
| [http://perplexcitycardcatalog.com/view.php?item=151 151]
|
| [http://perplexcitycardcatalog.com/view.php?item=017 017]
|-----
|
|
| I
|
| S
|
| T
|
|-----
| K
| [http://perplexcitycardcatalog.com/view.php?item=113 113]
|
| [http://perplexcitycardcatalog.com/view.php?item=053 053]
|
| [http://perplexcitycardcatalog.com/view.php?item=173 173]
|
| [http://perplexcitycardcatalog.com/view.php?item=023 023]
|-----
|
|
| O
|
| L
|
| E
|
|-----
| Q
| [http://perplexcitycardcatalog.com/view.php?item=011 011]
|
| [http://perplexcitycardcatalog.com/view.php?item=137 137]
|
| [http://perplexcitycardcatalog.com/view.php?item=149 149]
|
| [http://perplexcitycardcatalog.com/view.php?item=059 059]
|-----
|
|
| T
|
| H
|
| E
|
|-----
| J
| [http://perplexcitycardcatalog.com/view.php?item=019 019]
|
| [http://perplexcitycardcatalog.com/view.php?item=107 107]
|
| [http://perplexcitycardcatalog.com/view.php?item=251 251]
|
| [http://perplexcitycardcatalog.com/view.php?item=043 043]
|-----
|
|
| C
|
| U
|
| B
|
|-----
| 10
| [http://perplexcitycardcatalog.com/view.php?item=079 079]
|
| [http://perplexcitycardcatalog.com/view.php?item=181 181]
|
| [http://perplexcitycardcatalog.com/view.php?item=179 179]
|
| [http://perplexcitycardcatalog.com/view.php?item=241 241]
|-----
|
|
| E
|
| H
|
| E
|
|-----
| 9
| [http://perplexcitycardcatalog.com/view.php?item=047 047]
|
| [http://perplexcitycardcatalog.com/view.php?item=041 041]
|
| [http://perplexcitycardcatalog.com/view.php?item=109 109]
|
| [http://perplexcitycardcatalog.com/view.php?item=139 139]
|-----
|
|
| L
|
| P
|
| M
|
|-----
| 8
| [http://perplexcitycardcatalog.com/view.php?item=089 089]
|
| [http://perplexcitycardcatalog.com/view.php?item=013 013]
|
| [http://perplexcitycardcatalog.com/view.php?item=073 073]
|
| [http://perplexcitycardcatalog.com/view.php?item=002 002]
|-----
|
|
| E
|
| C
|
| O
|
|-----
| 7
| [http://perplexcitycardcatalog.com/view.php?item=003 003]
|
| [http://perplexcitycardcatalog.com/view.php?item=029 029]
|
| [http://perplexcitycardcatalog.com/view.php?item=005 005]
|
| [http://perplexcitycardcatalog.com/view.php?item=031 031]
|-----
|
|
| M
|
| B
|
| E
|
|-----
| 6
| [http://perplexcitycardcatalog.com/view.php?item=007 007]
|
| [http://perplexcitycardcatalog.com/view.php?item=037 037]
|
| [http://perplexcitycardcatalog.com/view.php?item=067 067]
|
| [http://perplexcitycardcatalog.com/view.php?item=071 071]
|-----
|
|
| D
|
| T
|
| H
|
|-----
| 5
| [http://perplexcitycardcatalog.com/view.php?item=061 061]
|
| [http://perplexcitycardcatalog.com/view.php?item=097 097]
|
| [http://perplexcitycardcatalog.com/view.php?item=127 127]
|
| [http://perplexcitycardcatalog.com/view.php?item=101 101]
|-----
|
|
| U
|
| N
|
| D
|
|-----
| 4
| [http://perplexcitycardcatalog.com/view.php?item=103 103]
|
| [http://perplexcitycardcatalog.com/view.php?item=131 131]
|
| [http://perplexcitycardcatalog.com/view.php?item=163 163]
|
| [http://perplexcitycardcatalog.com/view.php?item=167 167]
|-----
|
|
| E
|
| R
|
| C
|
|-----
| 3
| [http://perplexcitycardcatalog.com/view.php?item=193 193]
|
| [http://perplexcitycardcatalog.com/view.php?item=157 157]
|
| [http://perplexcitycardcatalog.com/view.php?item=197 197]
|
| [http://perplexcitycardcatalog.com/view.php?item=191 191]
|-----
|
|
| L
|
| A
|
| P
|
|-----
| 2
| [http://perplexcitycardcatalog.com/view.php?item=199 199]
|
| [http://perplexcitycardcatalog.com/view.php?item=227 227]
|
| [http://perplexcitycardcatalog.com/view.php?item=229 229]
|
| [http://perplexcitycardcatalog.com/view.php?item=233 233]
|-----
|
|
| -
|
| -
|
| -
|
|-----
| Jkr
| [http://perplexcitycardcatalog.com/view.php?item=223 223]
|
| [http://perplexcitycardcatalog.com/view.php?item=239 239]
|
|
|
|
|-----
|}
|}


== Wave 4 Meta Information ==


The message reads:
There are several puzzles contained in the Wave 4 Meta Information, and there is strong suspicion that these will be key to the finding of the eventual cube location.
:'''I stole [[the Cube]].  Help me.  [[Combed Thunderclap]].'''


This message along with other hints lead us to [http://perplexcityacademy.com/libraryofbabel/ Library of Babel subdirectory].  [[Combed Thunderclap]] has used that site  to communicate with us in a few flash updates.
The Meta Puzzles are:
*The [[Wave 4 Number Strings|Number Strings]]  - '''Partially Solved'''
 
Assuming the DNA spec leads to the translation for the letter srting we have:  
 
frbpulafhposmlucnidymendbkielgtpdoaakiltio
 
, which with MOD4ing each of the letters, then converting A = 1, U = 2, C = 3, G = 4 becomes:
 
UUUGAGAUGGCCAGACUAGAAAUGUCAAGCGGGCAACAGGAC
 
which using standard Codon interpretation becomes:
 
PHEGLUMETALAARGLEUGLUMETSERSERGLYGLNGLNASP
 
using 3 letter abbreviations or
 
FEMARLEMSSGQQD
 
using the single character codes for Amino Acids.  
 
OR, using the reverse, A = 2, U = 1, C = 4, G = 3 we get
 
AAACUCUACCGGUCUGAUCUUUACAGUUCGCCCGUUGUCCUG
 
which using standard Codon interpretation becomes:
 
LYSLEUTYRARGSERASPLEUTYPSERSERPROVALVALLEU
   
and
 
KLYRSDLYSSPVVL
 
*The [[Amorphous Blobs]] -- '''Solved'''
 
[[Image:Jurassic_blobs.png]]
*The [[Risk Pieces]] -- '''Open'''
*[[Individual Wave 4 Meta Puzzles|Other Individual Card Puzzles]] -- '''Partially Solved'''


== Wave 4 Meta Information ==
=== Raw Card Information ===


Note:  Updated as of November 20th and should be current.
Note:  Updated as of November 20th and should be current.
Line 486: Line 297:
|&nbsp;
|&nbsp;
|}
|}
=== Observations ===
* Numbers range from 1-4, including 1.5, 2.5, and 3.5.
* There are a total of 42 numbers.
* There are 42 territories in Risk.
* There are 11 numbers that start with "1-" and "2-" each, and 10 numbers that start with "3-" and "4-".
* In a 4-player game of Risk, two players start with 11 territories and two start with 10 territories.
* See the [[Number String Analysis]] page for further statistical, uh, analysis.
=== Speculations ===
* The ''Start Numbers'', or those before the first dash character, identify a player.
* The ''Middle Numbers'', or those between the dashes, could represent a path, where 1=South, 2=West, 3=North, 4=East.
* The ''Middle Numbers'' could represent conquests on a Risk map.
* The ''End Numbers'', or those after the second dash, could identify a player who ends up in control of a territory in Risk. There are 9 numbers that end in "2"; there are 9 regions in North America on a Risk board. There are 7 that end in "3"; there are 7 regions in Risk's Europe. There are 12 numbers that end in "4"; there are 12 regions in Risk's Asia. There are 14 that end in "1"; there are 14 regions in Risk's South America, Africa, and Australia continents combined.
=== Further Work ===
PerplexHero put the following shape together by joining the various map pieces together in card order. See the [http://forums.unfiction.com/forums/viewtopic.php?p=270299#270299 original post] for a zip file containing a hi-res version.
|[[Image:Map1.jpg]]
==Individual Puzzle Card Meta Puzzles==
* '''{{Card|084|Insights}}''' Wave 3 contains the following number string: "27.55.25.34.4.43.500.15.18.55.13.1.10.30.56.55.39.21.7.16.27.55.25.69.29.35.62.55"
**The card this is from relates to a few websites.  We have been flummoxed by the number .500 included in the number string. People have noted the repeat of the number 55 and the series of numbers 27.55.25.
* '''{{Card|156|Going Dotty}}''' Wave 4 contains the following message in hidden ink (although it has been noted that the degree of bold for each stone varies):
  '''RUBIESDIAMONDS'''EMERALD
  S'''TOPAZ'''AMETHYSTS'''SAPPHI'''
  '''RESRUBIESDIAMONDS'''EMER
  ALDS'''TOPAZ'''AMETHYSTS'''SAP'''
  '''PHIRESRUBIESDIAMONDS'''E
  MERALDS'''TOPAZ'''AMETHYSTS
  '''SAPPHIRESRUBIESDIAMON'''
  '''DS'''EMERALDS'''TOPAZ'''AMETHY
  STS'''SAPPHIRESRUBIESDIA'''
  '''MONDS'''EMERALDS'''TOPAZ'''AME
  THYSTS'''SAPPHIRESRUBIES'''
**This may relate to {{Card|030|End of the Line}} which contains the following quotation from [[Gyvann]]:
"Precious are the stones, my children, precious that which is dug from the
earth. Precious are the rubies, the diamonds, the emeralds and the topaz. I
held fast to the amethysts. They mingled them with sapphires, so I threw
them both from me. Only one choice remained and from then nothing was
right. My children I did not despair, as you must not despair. A quadru-
ped appeared before me, its middle leg held proudly forward. I turned my
back to it and strode forward. But after only 20 ammot the light was upon
me. Precious, my children, is the light." 
*'''{{Card|146|You are Cordially Invited}}''' which contains the following text visible under black-light:
  Electric Splash
  BB, 21 to 24
  4: C, V, K, Q
  20, V to 24
**We think these are the instructions given to the original Cube thieves about the night of the theft.
* '''{{Card|237|Roaming Identity}}'''  contains the following text printed in tiny writing:
  otpaaworldtdnia 1.56.29
**Anagrams and other things have been tried not yet successfully.  The title of the card might have something to do with this.
*''' {{Card|223|Secret Location}}''' Unrelated to the others, in a hard-to-see yellow text it says "100, 139, 6, 148, 62, 127, 118, 119, 131, 151, 146, 88, 135, 107, 112, 152, 124, 150, 130, 100, 147, 93, 121, 149, 134, 144, 126, 98, 133, 103, 143, 116, 63, 111, 91, 101, 70, 61, 105, 62, 76, 117, 123, 84, 102, 89, 115, 96, 137, 92, 85, 122, 87, 53, 104, 90, 145".<br>
**This message was [[Secret_Location_Meta_Information_Solution|successfully decoded]] on the 30th of October, 2006. It says:
{{quote}}
Five fingers point<br>
half the world<br>
realm<br>
region<br>
feature<br>
last mystery<br>
|}
*Possible puzzle data '''{{Card|242|Ciphers of History}}'''  This data is described as "dim letters on the stem of the R which spell out the chars 2, 10 and 11. From left to right top to bottom, a no7 shape to each repectively."
**When solved in the same method as the card, these characters translate to 464 which stands for ER.  Note that in solving the puzzle some of the letters had to be switched it could be ES or DR? 
-----
{{CardCat}}

Latest revision as of 07:50, 26 July 2007

PERPLEX CITY, SEASON ONE
The search for the Receda Cube on Earth


General

Some of the Puzzle Cards have playing card symbols, risk soldiers, dice, number strings, and obscure shapes on them. Each prime number card has a playing card symbol and part of a letter on it. Other cards have hidden text written in special ink.

We believe that Combed Thunderclap has put this data on the cards to help us find the Cube.

The first meta puzzle solved, the Prime Number puzzle consisting of card symbols and letters, gave us the message 'I STOLE THE CUBE. HELP ME. COMBED THUNDERCLAP.'

The second meta Puzzle solved, found in hidden text written on yellow letters on the Wave 4 cardSeason 1 Card #223 - Secret Location says "Five fingers point:half the world; realm; region; feature; last mystery." (Note all punctuation is added.)

The details of the solutions to these puzzles follows.

We have several more puzzles to solve.

Prime Number Cards: Playing Cards and Large Letters

Each card with a playing symbol also has part of a letter faintly printed over the card in a slab-serif font, and it's anticipated that arranging all the playing symbol cards in order will eventually depict the whole message. All symbols appear on cards with prime numbers. 54 Prime numbers under 256 are as follows:

2 3 5 7 11 13 17 19 23 29 31 37 41 43 47 53 59 61 67 71 73 79 83 89 97 101 103 107 109 113 127 131 137 139 149 151 157 163 167 173 179 181 191 193 197 199 211 223 227 229 233 239 241 251

See: List of Playing Cards for a plain list.

When oriented appropriately, these produce a text message on the corners of the cards. Full Details can be found on the Prime Number Message page.

This message along with other hints lead us to Library of Babel subdirectory. Combed Thunderclap has used that site to communicate with us in a few flash updates.

Season 1 Card #223 - Secret Location

This card has an additional set of numbers on it which are not related to the other Wave 4 Number Strings. These are printed in a hard-to-see yellow text and read:

"100, 139, 6, 148, 62, 127, 118, 119, 131, 151, 146, 88, 135, 107, 112, 152, 124, 150, 130, 100, 147, 93, 121, 149, 134, 144, 126, 98, 133, 103, 143, 116, 63, 111, 91, 101, 70, 61, 105, 62, 76, 117, 123, 84, 102, 89, 115, 96, 137, 92, 85, 122, 87, 53, 104, 90, 145".

This message is a form of Beale Cipher, and was successfully decoded on the 30th of October, 2006. When decoded it says:

Five fingers point

half the world
realm
region
feature
last mystery

Wave 4 Meta Information

There are several puzzles contained in the Wave 4 Meta Information, and there is strong suspicion that these will be key to the finding of the eventual cube location.

The Meta Puzzles are:

Assuming the DNA spec leads to the translation for the letter srting we have:

frbpulafhposmlucnidymendbkielgtpdoaakiltio

, which with MOD4ing each of the letters, then converting A = 1, U = 2, C = 3, G = 4 becomes:

UUUGAGAUGGCCAGACUAGAAAUGUCAAGCGGGCAACAGGAC


which using standard Codon interpretation becomes:

PHEGLUMETALAARGLEUGLUMETSERSERGLYGLNGLNASP


using 3 letter abbreviations or

FEMARLEMSSGQQD


using the single character codes for Amino Acids.

OR, using the reverse, A = 2, U = 1, C = 4, G = 3 we get

AAACUCUACCGGUCUGAUCUUUACAGUUCGCCCGUUGUCCUG


which using standard Codon interpretation becomes:

LYSLEUTYRARGSERASPLEUTYPSERSERPROVALVALLEU

and

KLYRSDLYSSPVVL


Jurassic blobs.png

Raw Card Information

Note: Updated as of November 20th and should be current. Please see Perplexorum or alternatively http://forums.unfiction.com/forums/viewtopic.php?t=16138 for more discussion.

Card Upright Number Reversed Number Shape Risk Char Red Dice Blue Dice Notes
Season 1 Card #029 - Beware the Puzzle Monsters 1-14443432.5-3 3-232.52.51.5-1 029shape.png       Card also contains playing card symbol.
Season 1 Card #040 - Baby On Board 2-11444414412-3 1-1144144414432.5-4 040.png 2 Infantry Red: 5, 4, 3 Blue: 4, 3 Attacker wins. Defender loses two armies. Shape is contained within the side of the elephant.
Season 1 Card #058 - Breaking And Entering 2-21122214-4 4-23232.534334-1 None 1 Cavalry Red: 6, 3, 1 Blue: 6, 4 This card and card 60 overlay each other to create one set of red/blue dice and 1 cavalry figure. Defender wins. Attacker loses two armies.
Season 1 Card #060 - Celebration 1-414141414144144441-1 4-44444444111111111114-3 None 1 Cavalry Red: 6, 3, 1 Blue: 6, 4 This card and card 58 overlay each other to create one set of red/blue dice and 1 cavalry figure. Defender wins. Attacker loses two armies
Season 1 Card #063 - The Next Generation 3-34-1 2-414441141-1 063shape.png        
Season 1 Card #090 - Also Known As 4-4444444443.5-1 3-433333334-2 None 3 Infantry Red: 4, 4, 3 Blue: 6, 3 Attacker and defender lose an army each.
Season 1 Card #094 - Prime Rhyme Crime 2-4111111441-2 1-1114112321-1 094shape.png       Numbers are vertical.
Season 1 Card #096 - Castle in The Sky 1-222233332-4 3-44411414441444112.5-4 096shape.png        
Season 1 Card #136 - Bling Bunny 3-2333234-1 4-143334-3 136shape.png       Numbers are vertical.
Season 1 Card #156 - Going Dotty 2-111221111112-4 2-2232-4 None       Numbers are vertical. This card has writing revealed under a black light. See below.
Season 1 Card #188 - Hybridization 4-11122221412234-2 2-21121111221-4 188shape.png       Numbers are across from each other in one line.
Season 1 Card #191 - My Dear Watson 2-11444444444411111111444-2 1-344411444443-1 191shape.png        
Season 1 Card #192 - Pronunciation 3-3333322333332-4 1-444444114411112-1 192shape.png        
Season 1 Card #203 - Ecliptic 4-33223333234-4 3-11144144144443-3 None       Numbers are vertical.
Season 1 Card #218 - The World 2-4444433333323-2 1-44334-3 218shape.png        
Season 1 Card #222 - Instigator 4-1414411122-2 3-34433333432-4 222shape.jpg       Numbers are vertical.
Season 1 Card #235 - Circuitous 1-4444444434444444444443-4 4-222233332222.5-1 235shape.png        
Season 1 Card #236 - Swarms 4-4333223323-3 3-2112223-2 None        
Season 1 Card #237 - Roaming Identity 3-3333334433334-1 2-1222323-2 237shape.png       Numbers are vertical. This card has micro-printing on it: "otpaaworldtdnia 1.56.29".
Season 1 Card #250 - Manoeuvers 4-3322333333333332-1 1-343-2 250shape.png       The number string 1-343-2 is in a bold font.
Season 1 Card #253 - Sightseeing 1-1111211112-4 2-111114441114114-1 253shape.png        
Retrieved from "https://perplexcitywiki.com/w/index.php?title=Puzzle_card_symbols&oldid=20544"