Puzzle card symbols: Difference between revisions

From Perplex City Wiki
Jump to navigationJump to search
mNo edit summary
No edit summary
 
(93 intermediate revisions by 18 users not shown)
Line 1: Line 1:
{{CardCat}}
{{Season1}}


== General ==
== General ==
Some of the cards have faint playing card symbols on. It was been speculated on [http://forums.unfiction.com/forums/viewtopic.php?t=11528&postdays=0&postorder=asc&start=30 Unfiction] that these may be a deck order for a solitaire cipher appearing on {{Card|243|Shuffled}}(See: [[Shuffled]]) but this appears to have been discredited. Each card with a playing symbol also has part of a letter faintly printed over the card in a slab-serif font, and it's anticipated that arranging all the playing symbol cards in order will eventually depict the whole message. So far, all symbols appear on cards with prime numbers, so this list will reflect that, until proven otherwise.


== A chart showing cards in order: ==
Some of the [[Puzzle Cards]] have playing card symbols, risk soldiers, dice, number strings, and obscure shapes on them. Each prime number card has a playing card symbol and part of a letter on it. Other cards have hidden text written in special ink.


Note the groupings of playing card symbols goes Club-Diamond-Heart-Spade, from Ace to 2 (ace high), forming 13 sets of 3 letters.
We believe that [[Combed Thunderclap]] has put this data on the cards to help us find the Cube.


Other notes:
The first meta puzzle solved, the Prime Number puzzle consisting of card symbols and letters, gave us the message 'I STOLE THE CUBE. HELP ME. COMBED THUNDERCLAP.
* Don't trust the black colouring 100% in the card catalogue - there may be a couple of cards that don't match by that alone - the original card should be re-checked to ensure accuracy of the black colourings.
* Cards aren't necessarily evenly cut down or across the middle of each letter, making calculating possibilities difficult.
* The font used is a simple thick seriffed font.  


The second meta Puzzle solved, found in hidden text written on yellow letters on the Wave 4 card{{Card|223|Secret Location}} says "Five fingers point:half the world; realm; region; feature; last mystery." (Note all punctuation is added.)


{| cellpadding=10 border=1
The details of the solutions to these puzzles follows.
|-----
 
|
We have several more puzzles to solve.
| Clubs
 
|
== Prime Number Cards: Playing Cards and Large Letters==
| Diamonds
Each card with a playing symbol also has part of a letter faintly printed over the card in a slab-serif font, and it's anticipated that arranging all the playing symbol cards in order will eventually depict the whole message. All symbols appear on cards with prime numbers. 54 Prime numbers under 256 are as follows:
|
 
| Hearts
2 3 5 7 11 13 17 19 23 29 31 37 41 43 47 53 59 61 67 71 73 79 83 89 97 101 103 107 109 113 127 131 137 139 149 151 157 163 167 173 179 181 191 193 197 199 211 223 227 229 233 239 241 251
|
 
| Spades
:''See: '''[[List of Playing Cards]]''' for a plain list.''
|-----
 
| Ace
When oriented appropriately, these produce a text message on the corners of the cards.  Full Details can be found on the [[Prime Number Message]] page.
| [http://perplexcitycardcatalog.com/view.php?item=211 211]
 
|
This message along with other hints lead us to [http://perplexcityacademy.com/libraryofbabel/ Library of Babel subdirectory]. [[Combed Thunderclap]] has used that site  to communicate with us in a few flash updates.
| [http://perplexcitycardcatalog.com/view.php?item=083 083]
 
|
== {{Card|223|Secret Location}} ==
| [http://perplexcitycardcatalog.com/view.php?item=151 151]
 
|
This card has an additional set of numbers on it which are not related to the other Wave 4 Number Strings. These are printed in a hard-to-see yellow text and read:<br>
| [http://perplexcitycardcatalog.com/view.php?item=017 017]
 
|-----
"100, 139, 6, 148, 62, 127, 118, 119, 131, 151, 146, 88, 135, 107, 112, 152, 124, 150, 130, 100, 147, 93, 121, 149, 134, 144, 126, 98, 133, 103, 143, 116, 63, 111, 91, 101, 70, 61, 105, 62, 76, 117, 123, 84, 102, 89, 115, 96, 137, 92, 85, 122, 87, 53, 104, 90, 145".<br>
|
 
|
This message is a form of [http://en.wikipedia.org/wiki/Beale_ciphers Beale Cipher], and was [[Secret_Location_Meta_Information_Solution|successfully decoded]] on the 30th of October, 2006. When decoded it says:  
| I
 
|
{{quote}}
| S
Five fingers point<br>
|
 
| T
half the world<br>
|
realm<br>
|-----
region<br>
| K
feature<br>
| [http://perplexcitycardcatalog.com/view.php?item=113 113]
last mystery<br>
|
| [http://perplexcitycardcatalog.com/view.php?item=053 053]
|
| [http://perplexcitycardcatalog.com/view.php?item=173 173]
|
| [http://perplexcitycardcatalog.com/view.php?item=023 023]
|-----
|
|
| O
|
| L
|
| E
|
|-----
| Q
| [http://perplexcitycardcatalog.com/view.php?item=011 011]
|
| [http://perplexcitycardcatalog.com/view.php?item=137 137]
|
| [http://perplexcitycardcatalog.com/view.php?item=149 149]
|
| [http://perplexcitycardcatalog.com/view.php?item=059 059]
|-----
|
|
| T
|
| H
|
| E
|
|-----
| J
| [http://perplexcitycardcatalog.com/view.php?item=019 019]
|
| [http://perplexcitycardcatalog.com/view.php?item=107 107]
|
| [http://perplexcitycardcatalog.com/view.php?item=251 251]
|
| [http://perplexcitycardcatalog.com/view.php?item=043 043]
|-----
|
|
| C
|
| U
|
| B
|
|-----
| 10
| [http://perplexcitycardcatalog.com/view.php?item=079 079]
|
| [http://perplexcitycardcatalog.com/view.php?item=181 181]
|
| [http://perplexcitycardcatalog.com/view.php?item=179 179]
|
| [http://perplexcitycardcatalog.com/view.php?item=241 241]
|-----
|
|
| E
|
| H
|
| E
|
|-----
| 9
| [http://perplexcitycardcatalog.com/view.php?item=047 047]
|
| [http://perplexcitycardcatalog.com/view.php?item=041 041]
|
| [http://perplexcitycardcatalog.com/view.php?item=109 109]
|
| [http://perplexcitycardcatalog.com/view.php?item=139 139]
|-----
|
|
| L
|
| P
|
| M
|
|-----
| 8
| [http://perplexcitycardcatalog.com/view.php?item=089 089]
|
| [http://perplexcitycardcatalog.com/view.php?item=013 013]
|
| [http://perplexcitycardcatalog.com/view.php?item=073 073]
|
|
|-----
|
|
| E
|
| C?
|
| O?
|
|-----
| 7
|
|
|
|
|
|
|
|-----
|
|
| -
|
| -
|
| -
|
|-----
| 6
|
|
|
|
|
|
|
|-----
|
|
| -
|
| -
|
| -
|
|-----
| 5
|
|
|
|
|
|
|
|-----
|
|
| -
|
| -
|
| -
|
|-----
| 4
|
|
|
|
|
|
|
|-----
|
|
| -
|
| -
|
| -
|
|-----
| 3
|
|
|
|
|
|
|
|-----
|
|
| -
|
| -
|
| -
|
|-----
| 2
|
|
|
|
|
|
|
|-----
|
|
| -
|
| -
|
| -
|
|-----
| Jkr
|
|
|
|
|
|
|
|-----
|}
|}


== Full known letter compilation: ==
== Wave 4 Meta Information ==
'''/IST/OLE/THE/CUB/EHE/LPM/E../.../.../.../.../.../.../'''
 
There are several puzzles contained in the Wave 4 Meta Information, and there is strong suspicion that these will be key to the finding of the eventual cube location.
 
The Meta Puzzles are:
*The [[Wave 4 Number Strings|Number Strings]]  - '''Partially Solved'''
 
Assuming the DNA spec leads to the translation for the letter srting we have:
 
frbpulafhposmlucnidymendbkielgtpdoaakiltio
 
, which with MOD4ing each of the letters, then converting A = 1, U = 2, C = 3, G = 4 becomes:


== A list of cards and their symbols: ==
UUUGAGAUGGCCAGACUAGAAAUGUCAAGCGGGCAACAGGAC
{| cellpadding=5
|-
 
| {{Card|002|Designer Flakes}}
which using standard Codon interpretation becomes:
|-
 
| {{Card|003|003}}
PHEGLUMETALAARGLEUGLUMETSERSERGLYGLNGLNASP
|-
| {{Card|005|005}}
 
|-
using 3 letter abbreviations or
| {{Card|007|007}}
 
|-
FEMARLEMSSGQQD
| {{Card|011|Revelation}}
| (Q of Clubs)
 
|-
using the single character codes for Amino Acids.  
| {{Card|013|Sphinx}}
 
| (8 of Diamonds)
OR, using the reverse, A = 2, U = 1, C = 4, G = 3 we get
|-
 
| {{Card|017|Easy As...}}
AAACUCUACCGGUCUGAUCUUUACAGUUCGCCCGUUGUCCUG
| (A of Spades)
|-
 
| {{Card|019|Magic Numbers}}
which using standard Codon interpretation becomes:
| (J of Clubs)
 
|-
LYSLEUTYRARGSERASPLEUTYPSERSERPROVALVALLEU
| {{Card|023|Pack 'O' Stars}}
| (K of Spades)
and
|-
 
| {{Card|029|029}}
KLYRSDLYSSPVVL
|-
| {{Card|031|031}}
 
|-
*The [[Amorphous Blobs]] -- '''Solved'''
| {{Card|037|037}}
 
|-
[[Image:Jurassic_blobs.png]]
| {{Card|041|Whipsmart Wordsearch}}
*The [[Risk Pieces]] -- '''Open'''
| (9 of Diamonds)
*[[Individual Wave 4 Meta Puzzles|Other Individual Card Puzzles]] -- '''Partially Solved'''
|-
 
| {{Card|043|Use Your Anterior Cingulate}}
=== Raw Card Information ===
| (J of Spades)
|-
| {{Card|047|Opposites Attract}}
| (9 of Clubs)
|-
| {{Card|053|Etaoin Schrdlu}}
| (K of Diamonds)
|-
| {{Card|059|Urban Myths}}
| (Q of Spades)
|-
| {{Card|061|061}}
|-
| {{Card|067|067}}
|-
| {{Card|071|071}}
|-
| {{Card|073|Animal Magic}}
| (8 of Hearts)
|-
| {{Card|079|Strange Loops}}
| (10 of Clubs)
|-
| {{Card|083|Pawnbroking}}
| (A of Diamonds)
|-
| {{Card|089|Forever Foe}}
| (8 of Clubs)
|-
| {{Card|097|097}}
|-
| {{Card|101|101}}
|-
| {{Card|103|103}}
|-
| {{Card|107|Blockword}}
| (J of Diamonds)
|-
| {{Card|109|Infinite Series}}
| (9 of Hearts)
|-
| {{Card|113|A Capital Idea}}
| (K of Clubs)
|-
| {{Card|127|127}}
|-
| {{Card|131|131}}
|-
| {{Card|137|Sub Rosa}}
| (Q of Diamonds)
|-
| {{Card|139|This Sentence Is False}}
| (9 of Spades)
|-
| {{Card|149|Complex Basic}}
| (Q of Hearts)
|-
| {{Card|151|Crazy Talk}}
| (A of Hearts)
|-
| {{Card|157|157}}
|-
| {{Card|163|163}}
|-
| {{Card|167|167}}
|-
| {{Card|173|The 14-15 Puzzle}}
| (K of Hearts)
|-
| {{Card|179|By Another Name}}
| (10 of Hearts)
|-
| {{Card|181|Down, A, B, Up, Up, Right}}
| (10 of Diamonds)
|-
| {{Card|191|191}}
|-
| {{Card|193|193}}
|-
| {{Card|197|197}}
|-
| {{Card|199|199}}
|-
| {{Card|211|Molecular}}
| (A of Clubs)
|-
| {{Card|223|223}}
|-
| {{Card|227|227}}
|-
| {{Card|229|229}}
|-
| {{Card|233|233}}
|-
| {{Card|239|239}}
|-
| {{Card|241|T-L-P}}
| (10 of Spades)
|-
| {{Card|251|The Thirteenth Labour}}
| (J of Hearts)
|}


== Primes ==
Note:  Updated as of November 20th and should be current.
54 Prime numbers under 255 are as follows:
Please see '''[http://www.perplexorum.com/showthread.php?t=362 Perplexorum]''' or alternatively http://forums.unfiction.com/forums/viewtopic.php?t=16138 for more discussion.


2 3 5 7 11 13 17 19 23 29 31 37 41 43 47 53 59 61 67 71 73 79 83 89 97 101 103 107 109 113 127 131 137 139 149 151 157 163 167 173 179 181 191 193 197 199 211 223 227 229 233 239 241 251
{| cellpadding=2 border=1
|------
|'''Card'''
|'''Upright Number'''
|'''Reversed Number'''
|'''Shape'''
|'''Risk Char'''
|'''Red Dice'''
|'''Blue Dice'''
|'''Notes'''
|------
|{{Card|029|Beware the Puzzle Monsters}}
|1-14443432.5-3
|3-232.52.51.5-1
|[[Image:029shape.png]]
|&nbsp;
|&nbsp;
|&nbsp;
|Card also contains playing card symbol.
|------
|{{Card|040|Baby On Board}}
|2-11444414412-3
|1-1144144414432.5-4
|[[Image:040.png]]
|2 Infantry
|Red: 5, 4, 3
|Blue: 4, 3
|Attacker wins. Defender loses two armies.  Shape is contained within the side of the elephant.
|------
|{{Card|058|Breaking And Entering}}
|2-21122214-4
|4-23232.534334-1
|None
|1 Cavalry
|Red: 6, 3, 1
|Blue: 6, 4
|This card and card 60 overlay each other to create one set of red/blue dice and 1 cavalry figure. Defender wins. Attacker loses two armies.
|------
|{{Card|060|Celebration}}
|1-414141414144144441-1
|4-44444444111111111114-3
|None
|1 Cavalry
|Red: 6, 3, 1
|Blue: 6, 4
|This card and card 58 overlay each other to create one set of red/blue dice and 1 cavalry figure. Defender wins. Attacker loses two armies
|------
|{{Card|063|The Next Generation}}
|3-34-1
|2-414441141-1
|[[Image:063shape.png]]
|&nbsp;
|&nbsp;
|&nbsp;
|&nbsp;
|------
|{{Card|090|Also Known As}}
|4-4444444443.5-1
|3-433333334-2
|None
|3 Infantry
|Red: 4, 4, 3
|Blue: 6, 3
|Attacker and defender lose an army each.
|------
|{{Card|094|Prime Rhyme Crime}}
|2-4111111441-2
|1-1114112321-1
|[[Image:094shape.png]]
|&nbsp;
|&nbsp;
|&nbsp;
|Numbers are vertical.
|------
|{{Card|096|Castle in The Sky}}
|1-222233332-4
|3-44411414441444112.5-4
|[[Image:096shape.png]]
|&nbsp;
|&nbsp;
|&nbsp;
|&nbsp;
|------
|{{Card|136|Bling Bunny}}
|3-2333234-1
|4-143334-3
|[[Image:136shape.png]]
|&nbsp;
|&nbsp;
|&nbsp;
|Numbers are vertical.
|------
|{{Card|156|Going Dotty}}
|2-111221111112-4
|2-2232-4
|None
|&nbsp;
|&nbsp;
|&nbsp;
|Numbers are vertical. This card has writing revealed under a black light. See below.
|------
|{{Card|188|Hybridization}}
|4-11122221412234-2
|2-21121111221-4
|[[Image:188shape.png]]
|&nbsp;
|&nbsp;
|&nbsp;
|Numbers are across from each other in one line.
|------
|{{Card|191|My Dear Watson}}
|2-11444444444411111111444-2
|1-344411444443-1
|[[Image:191shape.png]]
|&nbsp;
|&nbsp;
|&nbsp;
|&nbsp;
|------
|{{Card|192|Pronunciation}}
|3-3333322333332-4
|1-444444114411112-1
|[[Image:192shape.png]]
|&nbsp;
|&nbsp;
|&nbsp;
|&nbsp;
|------
|{{Card|203|Ecliptic}}
|4-33223333234-4
|3-11144144144443-3
|None
|&nbsp;
|&nbsp;
|&nbsp;
|Numbers are vertical.
|------
|{{Card|218|The World}}
|2-4444433333323-2
|1-44334-3
|[[Image:218shape.png]]
|&nbsp;
|&nbsp;
|&nbsp;
|&nbsp;
|------
|{{Card|222|Instigator}}
|4-1414411122-2
|3-34433333432-4
|[[Image:222shape.jpg]]
|&nbsp;
|&nbsp;
|&nbsp;
|Numbers are vertical.
|------
|{{Card|235|Circuitous}}
|1-4444444434444444444443-4
|4-222233332222.5-1
|[[Image:235shape.png]]
|&nbsp;
|&nbsp;
|&nbsp;
|&nbsp;
|------
|{{Card|236|Swarms}}
|4-4333223323-3
|3-2112223-2
|None
|&nbsp;
|&nbsp;
|&nbsp;
|&nbsp;
|------
|{{Card|237|Roaming Identity}}
|3-3333334433334-1
|2-1222323-2
|[[Image:237shape.png]]
|&nbsp;
|&nbsp;
|&nbsp;
|Numbers are vertical. This card has micro-printing on it: "otpaaworldtdnia 1.56.29".
|------
|{{Card|250|Manoeuvers}}
|4-3322333333333332-1
|1-343-2
|[[Image:250shape.png]]
|&nbsp;
|&nbsp;
|&nbsp;
|The number string 1-343-2 is in a bold font.
|------
|{{Card|253|Sightseeing}}
|1-1111211112-4
|2-111114441114114-1
|[[Image:253shape.png]]
|&nbsp;
|&nbsp;
|&nbsp;
|&nbsp;
|}

Latest revision as of 07:50, 26 July 2007

PERPLEX CITY, SEASON ONE
The search for the Receda Cube on Earth


General

Some of the Puzzle Cards have playing card symbols, risk soldiers, dice, number strings, and obscure shapes on them. Each prime number card has a playing card symbol and part of a letter on it. Other cards have hidden text written in special ink.

We believe that Combed Thunderclap has put this data on the cards to help us find the Cube.

The first meta puzzle solved, the Prime Number puzzle consisting of card symbols and letters, gave us the message 'I STOLE THE CUBE. HELP ME. COMBED THUNDERCLAP.'

The second meta Puzzle solved, found in hidden text written on yellow letters on the Wave 4 cardSeason 1 Card #223 - Secret Location says "Five fingers point:half the world; realm; region; feature; last mystery." (Note all punctuation is added.)

The details of the solutions to these puzzles follows.

We have several more puzzles to solve.

Prime Number Cards: Playing Cards and Large Letters

Each card with a playing symbol also has part of a letter faintly printed over the card in a slab-serif font, and it's anticipated that arranging all the playing symbol cards in order will eventually depict the whole message. All symbols appear on cards with prime numbers. 54 Prime numbers under 256 are as follows:

2 3 5 7 11 13 17 19 23 29 31 37 41 43 47 53 59 61 67 71 73 79 83 89 97 101 103 107 109 113 127 131 137 139 149 151 157 163 167 173 179 181 191 193 197 199 211 223 227 229 233 239 241 251

See: List of Playing Cards for a plain list.

When oriented appropriately, these produce a text message on the corners of the cards. Full Details can be found on the Prime Number Message page.

This message along with other hints lead us to Library of Babel subdirectory. Combed Thunderclap has used that site to communicate with us in a few flash updates.

Season 1 Card #223 - Secret Location

This card has an additional set of numbers on it which are not related to the other Wave 4 Number Strings. These are printed in a hard-to-see yellow text and read:

"100, 139, 6, 148, 62, 127, 118, 119, 131, 151, 146, 88, 135, 107, 112, 152, 124, 150, 130, 100, 147, 93, 121, 149, 134, 144, 126, 98, 133, 103, 143, 116, 63, 111, 91, 101, 70, 61, 105, 62, 76, 117, 123, 84, 102, 89, 115, 96, 137, 92, 85, 122, 87, 53, 104, 90, 145".

This message is a form of Beale Cipher, and was successfully decoded on the 30th of October, 2006. When decoded it says:

Five fingers point

half the world
realm
region
feature
last mystery

Wave 4 Meta Information

There are several puzzles contained in the Wave 4 Meta Information, and there is strong suspicion that these will be key to the finding of the eventual cube location.

The Meta Puzzles are:

Assuming the DNA spec leads to the translation for the letter srting we have:

frbpulafhposmlucnidymendbkielgtpdoaakiltio

, which with MOD4ing each of the letters, then converting A = 1, U = 2, C = 3, G = 4 becomes:

UUUGAGAUGGCCAGACUAGAAAUGUCAAGCGGGCAACAGGAC


which using standard Codon interpretation becomes:

PHEGLUMETALAARGLEUGLUMETSERSERGLYGLNGLNASP


using 3 letter abbreviations or

FEMARLEMSSGQQD


using the single character codes for Amino Acids.

OR, using the reverse, A = 2, U = 1, C = 4, G = 3 we get

AAACUCUACCGGUCUGAUCUUUACAGUUCGCCCGUUGUCCUG


which using standard Codon interpretation becomes:

LYSLEUTYRARGSERASPLEUTYPSERSERPROVALVALLEU

and

KLYRSDLYSSPVVL


Jurassic blobs.png

Raw Card Information

Note: Updated as of November 20th and should be current. Please see Perplexorum or alternatively http://forums.unfiction.com/forums/viewtopic.php?t=16138 for more discussion.

Card Upright Number Reversed Number Shape Risk Char Red Dice Blue Dice Notes
Season 1 Card #029 - Beware the Puzzle Monsters 1-14443432.5-3 3-232.52.51.5-1 029shape.png       Card also contains playing card symbol.
Season 1 Card #040 - Baby On Board 2-11444414412-3 1-1144144414432.5-4 040.png 2 Infantry Red: 5, 4, 3 Blue: 4, 3 Attacker wins. Defender loses two armies. Shape is contained within the side of the elephant.
Season 1 Card #058 - Breaking And Entering 2-21122214-4 4-23232.534334-1 None 1 Cavalry Red: 6, 3, 1 Blue: 6, 4 This card and card 60 overlay each other to create one set of red/blue dice and 1 cavalry figure. Defender wins. Attacker loses two armies.
Season 1 Card #060 - Celebration 1-414141414144144441-1 4-44444444111111111114-3 None 1 Cavalry Red: 6, 3, 1 Blue: 6, 4 This card and card 58 overlay each other to create one set of red/blue dice and 1 cavalry figure. Defender wins. Attacker loses two armies
Season 1 Card #063 - The Next Generation 3-34-1 2-414441141-1 063shape.png        
Season 1 Card #090 - Also Known As 4-4444444443.5-1 3-433333334-2 None 3 Infantry Red: 4, 4, 3 Blue: 6, 3 Attacker and defender lose an army each.
Season 1 Card #094 - Prime Rhyme Crime 2-4111111441-2 1-1114112321-1 094shape.png       Numbers are vertical.
Season 1 Card #096 - Castle in The Sky 1-222233332-4 3-44411414441444112.5-4 096shape.png        
Season 1 Card #136 - Bling Bunny 3-2333234-1 4-143334-3 136shape.png       Numbers are vertical.
Season 1 Card #156 - Going Dotty 2-111221111112-4 2-2232-4 None       Numbers are vertical. This card has writing revealed under a black light. See below.
Season 1 Card #188 - Hybridization 4-11122221412234-2 2-21121111221-4 188shape.png       Numbers are across from each other in one line.
Season 1 Card #191 - My Dear Watson 2-11444444444411111111444-2 1-344411444443-1 191shape.png        
Season 1 Card #192 - Pronunciation 3-3333322333332-4 1-444444114411112-1 192shape.png        
Season 1 Card #203 - Ecliptic 4-33223333234-4 3-11144144144443-3 None       Numbers are vertical.
Season 1 Card #218 - The World 2-4444433333323-2 1-44334-3 218shape.png        
Season 1 Card #222 - Instigator 4-1414411122-2 3-34433333432-4 222shape.jpg       Numbers are vertical.
Season 1 Card #235 - Circuitous 1-4444444434444444444443-4 4-222233332222.5-1 235shape.png        
Season 1 Card #236 - Swarms 4-4333223323-3 3-2112223-2 None        
Season 1 Card #237 - Roaming Identity 3-3333334433334-1 2-1222323-2 237shape.png       Numbers are vertical. This card has micro-printing on it: "otpaaworldtdnia 1.56.29".
Season 1 Card #250 - Manoeuvers 4-3322333333333332-1 1-343-2 250shape.png       The number string 1-343-2 is in a bold font.
Season 1 Card #253 - Sightseeing 1-1111211112-4 2-111114441114114-1 253shape.png