Puzzle card symbols: Difference between revisions
Chimera245 (talk | contribs) No edit summary |
|||
| (39 intermediate revisions by 7 users not shown) | |||
| Line 1: | Line 1: | ||
{{Season1}} | |||
== General == | == General == | ||
Some of the [[Puzzle Cards]] have playing card symbols, risk soldiers, dice, number strings, and obscure shapes on them. Each prime number card has a playing card symbol and part of a letter on it. Other cards have hidden text written in special ink. | |||
We believe that [[Combed Thunderclap]] has put this data on the cards to help us find the Cube. | |||
The first meta puzzle solved, the Prime Number puzzle consisting of card symbols and letters, gave us the message 'I STOLE THE CUBE. HELP ME. COMBED THUNDERCLAP.' | |||
The second meta Puzzle solved, found in hidden text written on yellow letters on the Wave 4 card{{Card|223|Secret Location}} says "Five fingers point:half the world; realm; region; feature; last mystery." (Note all punctuation is added.) | |||
==Playing Cards and Large Letters== | The details of the solutions to these puzzles follows. | ||
We have several more puzzles to solve. | |||
== Prime Number Cards: Playing Cards and Large Letters== | |||
Each card with a playing symbol also has part of a letter faintly printed over the card in a slab-serif font, and it's anticipated that arranging all the playing symbol cards in order will eventually depict the whole message. All symbols appear on cards with prime numbers. 54 Prime numbers under 256 are as follows: | Each card with a playing symbol also has part of a letter faintly printed over the card in a slab-serif font, and it's anticipated that arranging all the playing symbol cards in order will eventually depict the whole message. All symbols appear on cards with prime numbers. 54 Prime numbers under 256 are as follows: | ||
| Line 10: | Line 22: | ||
:''See: '''[[List of Playing Cards]]''' for a plain list.'' | :''See: '''[[List of Playing Cards]]''' for a plain list.'' | ||
When oriented appropriately, these produce a text message on the corners of the cards. Full Details can be found on the [[Prime Number Message]] page. | |||
This message along with other hints lead us to [http://perplexcityacademy.com/libraryofbabel/ Library of Babel subdirectory]. [[Combed Thunderclap]] has used that site to communicate with us in a few flash updates. | |||
== {{Card|223|Secret Location}} == | |||
This card has an additional set of numbers on it which are not related to the other Wave 4 Number Strings. These are printed in a hard-to-see yellow text and read:<br> | |||
"100, 139, 6, 148, 62, 127, 118, 119, 131, 151, 146, 88, 135, 107, 112, 152, 124, 150, 130, 100, 147, 93, 121, 149, 134, 144, 126, 98, 133, 103, 143, 116, 63, 111, 91, 101, 70, 61, 105, 62, 76, 117, 123, 84, 102, 89, 115, 96, 137, 92, 85, 122, 87, 53, 104, 90, 145".<br> | |||
This message is a form of [http://en.wikipedia.org/wiki/Beale_ciphers Beale Cipher], and was [[Secret_Location_Meta_Information_Solution|successfully decoded]] on the 30th of October, 2006. When decoded it says: | |||
{{quote}} | |||
Five fingers point<br> | |||
half the world<br> | |||
realm<br> | |||
region<br> | |||
feature<br> | |||
last mystery<br> | |||
| | |||
|} | |} | ||
== Wave 4 Meta Information == | |||
There are several puzzles contained in the Wave 4 Meta Information, and there is strong suspicion that these will be key to the finding of the eventual cube location. | |||
The Meta Puzzles are: | |||
*The [[Wave 4 Number Strings|Number Strings]] - '''Partially Solved''' | |||
Assuming the DNA spec leads to the translation for the letter srting we have: | |||
frbpulafhposmlucnidymendbkielgtpdoaakiltio | |||
, which with MOD4ing each of the letters, then converting A = 1, U = 2, C = 3, G = 4 becomes: | |||
UUUGAGAUGGCCAGACUAGAAAUGUCAAGCGGGCAACAGGAC | |||
which using standard Codon interpretation becomes: | |||
PHEGLUMETALAARGLEUGLUMETSERSERGLYGLNGLNASP | |||
using 3 letter abbreviations or | |||
FEMARLEMSSGQQD | |||
using the single character codes for Amino Acids. | |||
OR, using the reverse, A = 2, U = 1, C = 4, G = 3 we get | |||
AAACUCUACCGGUCUGAUCUUUACAGUUCGCCCGUUGUCCUG | |||
which using standard Codon interpretation becomes: | |||
LYSLEUTYRARGSERASPLEUTYPSERSERPROVALVALLEU | |||
and | |||
KLYRSDLYSSPVVL | |||
*The [[Amorphous Blobs]] -- '''Solved''' | |||
[[Image:Jurassic_blobs.png]] | |||
*The [[Risk Pieces]] -- '''Open''' | |||
*[[Individual Wave 4 Meta Puzzles|Other Individual Card Puzzles]] -- '''Partially Solved''' | |||
=== Raw Card Information === | |||
Note: | Note: Updated as of November 20th and should be current. | ||
Please see '''[http://www.perplexorum.com/showthread.php?t=362 Perplexorum]''' or alternatively http://forums.unfiction.com/forums/viewtopic.php?t=16138 for | Please see '''[http://www.perplexorum.com/showthread.php?t=362 Perplexorum]''' or alternatively http://forums.unfiction.com/forums/viewtopic.php?t=16138 for more discussion. | ||
{| cellpadding=2 border=1 | {| cellpadding=2 border=1 | ||
| Line 312: | Line 124: | ||
|Red: 5, 4, 3 | |Red: 5, 4, 3 | ||
|Blue: 4, 3 | |Blue: 4, 3 | ||
|Attacker wins. Shape is contained within the side of the elephant. | |Attacker wins. Defender loses two armies. Shape is contained within the side of the elephant. | ||
|------ | |------ | ||
|{{Card|058|Breaking And Entering}} | |{{Card|058|Breaking And Entering}} | ||
|2-21122214-4 | |2-21122214-4 | ||
|4-23232.534334-1 | |4-23232.534334-1 | ||
| | |None | ||
|1 Cavalry | |1 Cavalry | ||
|Red: 6, 3, 1 | |Red: 6, 3, 1 | ||
|Blue: 6, 4 | |Blue: 6, 4 | ||
|This card and card 60 overlay each other to create one set of red/blue dice and 1 cavalry figure. Defender wins. | |This card and card 60 overlay each other to create one set of red/blue dice and 1 cavalry figure. Defender wins. Attacker loses two armies. | ||
|------ | |------ | ||
|{{Card|060|Celebration}} | |{{Card|060|Celebration}} | ||
| Line 330: | Line 142: | ||
|Red: 6, 3, 1 | |Red: 6, 3, 1 | ||
|Blue: 6, 4 | |Blue: 6, 4 | ||
|This card and card 58 overlay each other to create one set of red/blue dice and 1 cavalry figure. Defender wins. | |This card and card 58 overlay each other to create one set of red/blue dice and 1 cavalry figure. Defender wins. Attacker loses two armies | ||
|------ | |------ | ||
|{{Card|063|The Next Generation}} | |{{Card|063|The Next Generation}} | ||
| Line 384: | Line 196: | ||
| | | | ||
| | | | ||
|Numbers are vertical. This card has writing revealed under a black light. | |Numbers are vertical. This card has writing revealed under a black light. See below. | ||
|------ | |------ | ||
|{{Card|188|Hybridization}} | |{{Card|188|Hybridization}} | ||
| Line 393: | Line 205: | ||
| | | | ||
| | | | ||
| | |Numbers are across from each other in one line. | ||
|------ | |------ | ||
|{{Card|191|My Dear Watson}} | |{{Card|191|My Dear Watson}} | ||
| Line 474: | Line 286: | ||
| | | | ||
| | | | ||
| | |The number string 1-343-2 is in a bold font. | ||
|------ | |------ | ||
|{{Card|253|Sightseeing}} | |{{Card|253|Sightseeing}} | ||
| Line 485: | Line 297: | ||
| | | | ||
|} | |} | ||
Latest revision as of 07:50, 26 July 2007
|
PERPLEX CITY, SEASON ONE |
General
Some of the Puzzle Cards have playing card symbols, risk soldiers, dice, number strings, and obscure shapes on them. Each prime number card has a playing card symbol and part of a letter on it. Other cards have hidden text written in special ink.
We believe that Combed Thunderclap has put this data on the cards to help us find the Cube.
The first meta puzzle solved, the Prime Number puzzle consisting of card symbols and letters, gave us the message 'I STOLE THE CUBE. HELP ME. COMBED THUNDERCLAP.'
The second meta Puzzle solved, found in hidden text written on yellow letters on the Wave 4 cardSeason 1 Card #223 - Secret Location says "Five fingers point:half the world; realm; region; feature; last mystery." (Note all punctuation is added.)
The details of the solutions to these puzzles follows.
We have several more puzzles to solve.
Prime Number Cards: Playing Cards and Large Letters
Each card with a playing symbol also has part of a letter faintly printed over the card in a slab-serif font, and it's anticipated that arranging all the playing symbol cards in order will eventually depict the whole message. All symbols appear on cards with prime numbers. 54 Prime numbers under 256 are as follows:
2 3 5 7 11 13 17 19 23 29 31 37 41 43 47 53 59 61 67 71 73 79 83 89 97 101 103 107 109 113 127 131 137 139 149 151 157 163 167 173 179 181 191 193 197 199 211 223 227 229 233 239 241 251
- See: List of Playing Cards for a plain list.
When oriented appropriately, these produce a text message on the corners of the cards. Full Details can be found on the Prime Number Message page.
This message along with other hints lead us to Library of Babel subdirectory. Combed Thunderclap has used that site to communicate with us in a few flash updates.
Season 1 Card #223 - Secret Location
This card has an additional set of numbers on it which are not related to the other Wave 4 Number Strings. These are printed in a hard-to-see yellow text and read:
"100, 139, 6, 148, 62, 127, 118, 119, 131, 151, 146, 88, 135, 107, 112, 152, 124, 150, 130, 100, 147, 93, 121, 149, 134, 144, 126, 98, 133, 103, 143, 116, 63, 111, 91, 101, 70, 61, 105, 62, 76, 117, 123, 84, 102, 89, 115, 96, 137, 92, 85, 122, 87, 53, 104, 90, 145".
This message is a form of Beale Cipher, and was successfully decoded on the 30th of October, 2006. When decoded it says:
|
Five fingers point half the world |
Wave 4 Meta Information
There are several puzzles contained in the Wave 4 Meta Information, and there is strong suspicion that these will be key to the finding of the eventual cube location.
The Meta Puzzles are:
- The Number Strings - Partially Solved
Assuming the DNA spec leads to the translation for the letter srting we have:
frbpulafhposmlucnidymendbkielgtpdoaakiltio
, which with MOD4ing each of the letters, then converting A = 1, U = 2, C = 3, G = 4 becomes:
UUUGAGAUGGCCAGACUAGAAAUGUCAAGCGGGCAACAGGAC
which using standard Codon interpretation becomes:
PHEGLUMETALAARGLEUGLUMETSERSERGLYGLNGLNASP
using 3 letter abbreviations or
FEMARLEMSSGQQD
using the single character codes for Amino Acids.
OR, using the reverse, A = 2, U = 1, C = 4, G = 3 we get
AAACUCUACCGGUCUGAUCUUUACAGUUCGCCCGUUGUCCUG
which using standard Codon interpretation becomes:
LYSLEUTYRARGSERASPLEUTYPSERSERPROVALVALLEU
and
KLYRSDLYSSPVVL
- The Amorphous Blobs -- Solved
- The Risk Pieces -- Open
- Other Individual Card Puzzles -- Partially Solved
Raw Card Information
Note: Updated as of November 20th and should be current. Please see Perplexorum or alternatively http://forums.unfiction.com/forums/viewtopic.php?t=16138 for more discussion.
| Card | Upright Number | Reversed Number | Shape | Risk Char | Red Dice | Blue Dice | Notes |
| Season 1 Card #029 - Beware the Puzzle Monsters | 1-14443432.5-3 | 3-232.52.51.5-1 |
|
Card also contains playing card symbol. | |||
| Season 1 Card #040 - Baby On Board | 2-11444414412-3 | 1-1144144414432.5-4 | 2 Infantry | Red: 5, 4, 3 | Blue: 4, 3 | Attacker wins. Defender loses two armies. Shape is contained within the side of the elephant. | |
| Season 1 Card #058 - Breaking And Entering | 2-21122214-4 | 4-23232.534334-1 | None | 1 Cavalry | Red: 6, 3, 1 | Blue: 6, 4 | This card and card 60 overlay each other to create one set of red/blue dice and 1 cavalry figure. Defender wins. Attacker loses two armies. |
| Season 1 Card #060 - Celebration | 1-414141414144144441-1 | 4-44444444111111111114-3 | None | 1 Cavalry | Red: 6, 3, 1 | Blue: 6, 4 | This card and card 58 overlay each other to create one set of red/blue dice and 1 cavalry figure. Defender wins. Attacker loses two armies |
| Season 1 Card #063 - The Next Generation | 3-34-1 | 2-414441141-1 | |||||
| Season 1 Card #090 - Also Known As | 4-4444444443.5-1 | 3-433333334-2 | None | 3 Infantry | Red: 4, 4, 3 | Blue: 6, 3 | Attacker and defender lose an army each. |
| Season 1 Card #094 - Prime Rhyme Crime | 2-4111111441-2 | 1-1114112321-1 | Numbers are vertical. | ||||
| Season 1 Card #096 - Castle in The Sky | 1-222233332-4 | 3-44411414441444112.5-4 | |||||
| Season 1 Card #136 - Bling Bunny | 3-2333234-1 | 4-143334-3 | Numbers are vertical. | ||||
| Season 1 Card #156 - Going Dotty | 2-111221111112-4 | 2-2232-4 | None | Numbers are vertical. This card has writing revealed under a black light. See below. | |||
| Season 1 Card #188 - Hybridization | 4-11122221412234-2 | 2-21121111221-4 |
|
Numbers are across from each other in one line. | |||
| Season 1 Card #191 - My Dear Watson | 2-11444444444411111111444-2 | 1-344411444443-1 | |||||
| Season 1 Card #192 - Pronunciation | 3-3333322333332-4 | 1-444444114411112-1 | |||||
| Season 1 Card #203 - Ecliptic | 4-33223333234-4 | 3-11144144144443-3 | None | Numbers are vertical. | |||
| Season 1 Card #218 - The World | 2-4444433333323-2 | 1-44334-3 |
|
||||
| Season 1 Card #222 - Instigator | 4-1414411122-2 | 3-34433333432-4 | Numbers are vertical. | ||||
| Season 1 Card #235 - Circuitous | 1-4444444434444444444443-4 | 4-222233332222.5-1 |
|
||||
| Season 1 Card #236 - Swarms | 4-4333223323-3 | 3-2112223-2 | None | ||||
| Season 1 Card #237 - Roaming Identity | 3-3333334433334-1 | 2-1222323-2 |
|
Numbers are vertical. This card has micro-printing on it: "otpaaworldtdnia 1.56.29". | |||
| Season 1 Card #250 - Manoeuvers | 4-3322333333333332-1 | 1-343-2 | The number string 1-343-2 is in a bold font. | ||||
| Season 1 Card #253 - Sightseeing | 1-1111211112-4 | 2-111114441114114-1 |
|






